Loading...

Detail Information of piRNA: piR-mmu-90324

General Information
piRBase Id piR-mmu-90324 Accession N/A
Organism Mouse Number of methods 4
Sequence TCTGAAAAGTTGGTAGGCTGGAAGTAAC Number of papers 10
Length 28 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 41 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 45 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 22 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 143 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 152 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 26 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 48 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
52 GSM610967 4 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
71 GSM509280 1 20439430 small RNA MitoPLD-/- 10 dpp testis
121 GSM545783 34 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 3 20022248 Miwi IP adult testis
217 GSM1653802 6 25582079 MIWI CLIP round spermatids
225 GSM1528807 26 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 39 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 59 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 69 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 6 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 4 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 3 20022248 Miwi-IP testis 
347 GSM475281 3 20022248 small RNA testis 
359 GSM4635232 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
445 GSM1096584 8 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 5 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 3 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 18 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 6 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 18 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 14 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 27 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 9:54246927-54246955:- Cyp19a1 ENSMUST00000214358;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 6.8347
Sample CPM
GSM400968 1.1724
GSM400969 0
GSM433288 0
GSM433289 0.4375
GSM433290 1.2742
GSM433291 1.4229
GSM433292 2.6744
GSM433293 2.1269
GSM433294 0
GSM433295 0
GSM475279 0.2882
GSM475280 0
GSM475281 0.2814
GSM678422 0
The Expression of piRNA: piR-mmu-90324
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.