Loading...

Detail Information of piRNA: piR-mmu-893

General Information
piRBase Id piR-mmu-893 Accession DQ713790
Organism Mouse Number of methods 5
Sequence TGCCAACTGACTTCTCTCCGATGCCC Number of papers 12
Length 26 Golden piRNA -
Aliases piR-17768; piR-129112; PIR10767; PIR222438;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
35 GSM684620 38 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
73 N/A 1 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
121 GSM545783 2 20534472 Mov10L1 IP wild type adult testis
133 GSM475280 1 20022248 Mili IP adult testis
217 GSM1653802 12 25582079 MIWI CLIP round spermatids
225 GSM1528807 9 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 16 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 27 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 24 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 3 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 6 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
346 GSM475280 1 20022248 Mili-IP testis 
441 GSM1096582 6 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 36 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 43 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 136 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 150 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 6 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 4 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 25 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 31 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 11 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 12 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:62228325-62228351:- Zfp37 ENSMUST00000212325; LTR ERVL-MaLR MTA_Mm;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0.4649
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.3107
Sample CPM
GSM400968 0.3908
GSM400969 0
GSM433288 0.7026
GSM433289 1.3124
GSM433290 0.6371
GSM433291 0.3557
GSM433292 0.4863
GSM433293 0.4254
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0.0909
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-893
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.