Loading...

Detail Information of piRNA: piR-mmu-8841

General Information
piRBase Id piR-mmu-8841 Accession DQ556929
Organism Mouse Number of methods 3
Sequence TGTATTGGTGAGAGGTCCCCCAAGC Number of papers 5
Length 25 Golden piRNA -
Aliases piR-24041; PIR18040;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
60 GSM319956 1 18922463 Mili IP 16.5 dpc testis
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
118 GSM958039 1 22902560 Mili IP Tdrd1 +/-,E18,testis
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
240 GSM433294 2 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
443 GSM1096583 1 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 8 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
4 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:103480189-103480214:-
Location 2 10:83471056-83471081:+ D10Wsu102e ENSMUST00000020488; LTR ERVK RMER20C_Mm;
Location 3 2:160636489-160636514:+ Simple_repeat Simple_repeat (TTTTTA)n;
Location 4 8:106488228-106488253:- LTR ERV1 RLTR14;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0.4649
GSM319955 0
GSM319956 2.1202
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0.4375
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0.4693
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-8841
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.