Loading...

Detail Information of piRNA: piR-mmu-871

General Information
piRBase Id piR-mmu-871 Accession DQ549636
Organism Mouse Number of methods 1
Sequence TGCCAACCAATAACTGCCTATAGATTCTTAT Number of papers 3
Length 31 Golden piRNA -
Aliases piR-17748; PIR10747;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
224 GSM1528806 3 26588211 small RNA 10dpp testes
225 GSM1528807 11 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 17 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 11 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 9 26588211 small RNA Adult testes Asb1 ao36(KO)
443 GSM1096583 2 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 3 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 1 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27307237-27307268:-
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.