Loading...
piRBase Id | piR-mmu-871 | Accession | DQ549636 |
---|---|---|---|
Organism | Mouse | Number of methods | 1 |
Sequence | TGCCAACCAATAACTGCCTATAGATTCTTAT | Number of papers | 3 |
Length | 31 | Golden piRNA | - |
Aliases | piR-17748; PIR10747; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
224 | GSM1528806 | 3 | 26588211 | small RNA | 10dpp testes |
225 | GSM1528807 | 11 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 17 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 11 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 9 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
443 | GSM1096583 | 2 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 3 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
447 | GSM1096585 | 1 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
451 | GSM1096587 | 2 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 17:27307237-27307268:- |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |