Loading...

Detail Information of piRNA: piR-mmu-87

General Information
piRBase Id piR-mmu-87 Accession DQ699303
Organism Mouse Number of methods 4
Sequence TGCAATCTATTGGAGAGAAAGTTTCAGTTG Number of papers 7
Length 30 Golden piRNA -
Aliases piR-17079; piR-114625; PIR10078; PIR207951;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
31 GSM684624 412 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 178 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 17 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 16 22842725 Miwi CLIP C57BL/6 adult testis
217 GSM1653802 55 25582079 MIWI CLIP round spermatids
225 GSM1528807 25 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 69 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 71 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 63 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 15 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 9 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 100 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 41 26115953 small RNA 25dpp homo tdrd6 KO testes
441 GSM1096582 7 23523368 small RNA Wild Type 10.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 25 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 20 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 17 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 27 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 20 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 20 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 14 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 10:22053424-22053454:- Gm18637 ENSMUST00000217665; LTR ERVL-MaLR MTA_Mm; LINE L1 Lx;
Location 2 6:128188055-128188085:- Gm18609 ENSMUST00000203370; Gm10010 ENSMUST00000071101;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.5128
GSM433289 1.9687
GSM433290 21.2374
GSM433291 14.5848
GSM433292 25.7716
GSM433293 24.2467
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-87
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.