Loading...
piRBase Id | piR-mmu-852 | Accession | DQ539962 |
---|---|---|---|
Organism | Mouse | Number of methods | 2 |
Sequence | AATCTTGCTAGTGTATGCAATGGTGTCA | Number of papers | 7 |
Length | 28 | Golden piRNA | Y |
Aliases | piR-74; PIR1073; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
58 | GSM319954 | 2 | 18922463 | Mili IP | 10 dpp Dnmt3L KO testis |
59 | GSM319955 | 27 | 18922463 | small RNA | 16.5 dpc testis |
61 | GSM319957 | 62 | 18922463 | Miwi2 IP | 16.5 dpc testis |
62 | GSM319958 | 1 | 18922463 | small RNA | 4-6 week ovary |
76 | N/A | 1 | 22020280 | Mili IP | Miwi2DAH_2 E16.5 fetal testis |
81 | N/A | 5 | 22020280 | Mili IP | wild_type_1 E16.5 fetal testis |
82 | N/A | 2 | 22020280 | Mili IP | wild_type_2 E16.5 fetal testis |
83 | N/A | 1 | 22020280 | Miwi2 IP | MiliDAH_1 E16.5 fetal testis |
88 | N/A | 1 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
225 | GSM1528807 | 2 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 3 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 3 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
234 | GSM433288 | 2 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
235 | GSM433289 | 9 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
236 | GSM433290 | 4 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
237 | GSM433291 | 1 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
238 | GSM433292 | 2 | 26115953 | small RNA | 6 weeks hetero tdrd6 KO testes |
240 | GSM433294 | 14 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
347 | GSM475281 | 3 | 20022248 | small RNA | testis |
445 | GSM1096584 | 9 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
451 | GSM1096587 | 2 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 1:180846942-180846970:- | LTR ERVL-MaLR MTD; LTR ERVK RMER17C; | |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0.8221 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0.9298 |
GSM319955 | 16.3839 |
GSM319956 | 0 |
GSM319957 | 31.9536 |
GSM319958 | 1.6113 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0.4684 |
GSM433289 | 1.9687 |
GSM433290 | 0.8495 |
GSM433291 | 0.3557 |
GSM433292 | 0.4863 |
GSM433293 | 0.4254 |
GSM433294 | 3.2851 |
GSM433295 | 0.2378 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0.2814 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
---|---|---|---|
Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |