Loading...

Detail Information of piRNA: piR-mmu-852

General Information
piRBase Id piR-mmu-852 Accession DQ539962
Organism Mouse Number of methods 2
Sequence AATCTTGCTAGTGTATGCAATGGTGTCA Number of papers 7
Length 28 Golden piRNA Y
Aliases piR-74; PIR1073;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
58 GSM319954 2 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 27 18922463 small RNA 16.5 dpc testis
61 GSM319957 62 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 1 18922463 small RNA 4-6 week ovary
76 N/A 1 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
81 N/A 5 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 2 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 1 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
225 GSM1528807 2 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 3 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 3 26588211 small RNA Adult testes Asb1 ao34(Het)
234 GSM433288 2 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 9 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 4 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 2 26115953 small RNA 6 weeks hetero tdrd6 KO testes
240 GSM433294 14 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
347 GSM475281 3 20022248 small RNA testis 
445 GSM1096584 9 23523368 small RNA Wild Type 14.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
30979 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:180846942-180846970:- LTR ERVL-MaLR MTD; LTR ERVK RMER17C;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0.8221
GSM261959 0
GSM319953 0
GSM319954 0.9298
GSM319955 16.3839
GSM319956 0
GSM319957 31.9536
GSM319958 1.6113
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.4684
GSM433289 1.9687
GSM433290 0.8495
GSM433291 0.3557
GSM433292 0.4863
GSM433293 0.4254
GSM433294 3.2851
GSM433295 0.2378
GSM475279 0
GSM475280 0
GSM475281 0.2814
GSM678422 0
The Expression of piRNA: piR-mmu-852
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.