Loading...
| piRBase Id | piR-mmu-82 | Accession | DQ548962 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGCAATCAAATTCCAGGTCTCATTCACCAA | Number of papers | 10 |
| Length | 30 | Golden piRNA | - |
| Aliases | piR-17074; PIR10073; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 11 | GSM822760 | 7 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 12 | GSM822758 | 9 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 13 | GSM822759 | 5 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
| 14 | GSM822761 | 3 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 17 | GSM822764 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 31 | GSM684624 | 5 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 52 | GSM610967 | 1 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 68 | GSM509277 | 1 | 20439430 | small RNA | Mili-/- E16.5 testis |
| 133 | GSM475280 | 1 | 20022248 | Mili IP | adult testis |
| 217 | GSM1653802 | 5 | 25582079 | MIWI CLIP | round spermatids |
| 225 | GSM1528807 | 1 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 6 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 20 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 29 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 235 | GSM433289 | 1 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 1 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 1 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 346 | GSM475280 | 1 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 8 | 20022248 | small RNA | testis |
| 447 | GSM1096585 | 1 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 1 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 17:27299832-27299862:- | SINE B2 B3A; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0 |
| GSM433289 | 0.2187 |
| GSM433290 | 0.2124 |
| GSM433291 | 0.3557 |
| GSM433292 | 0.2431 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0.0909 |
| GSM475281 | 0.7505 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
|---|---|---|---|
| Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
| Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||