Loading...

Detail Information of piRNA: piR-mmu-82

General Information
piRBase Id piR-mmu-82 Accession DQ548962
Organism Mouse Number of methods 3
Sequence TGCAATCAAATTCCAGGTCTCATTCACCAA Number of papers 10
Length 30 Golden piRNA -
Aliases piR-17074; PIR10073;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 9 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 5 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 5 22842725 Miwi CLIP C57BL/6 adult testis
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
68 GSM509277 1 20439430 small RNA Mili-/- E16.5 testis
133 GSM475280 1 20022248 Mili IP adult testis
217 GSM1653802 5 25582079 MIWI CLIP round spermatids
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 6 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 20 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 29 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
346 GSM475280 1 20022248 Mili-IP testis 
347 GSM475281 8 20022248 small RNA testis 
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27299832-27299862:- SINE B2 B3A;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0.2187
GSM433290 0.2124
GSM433291 0.3557
GSM433292 0.2431
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0.0909
GSM475281 0.7505
GSM678422 0
The Expression of piRNA: piR-mmu-82
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.