Loading...

Detail Information of piRNA: piR-mmu-81732

General Information
piRBase Id piR-mmu-81732 Accession N/A
Organism Mouse Number of methods 4
Sequence TTTTATCACAGCAACAGAAAGGAAACTAGGA Number of papers 8
Length 31 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 90 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 21 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 60 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 32 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 87 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 87 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 14 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 4 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 5 21602304 small RNA Male germ cell, Round spermatids
132 GSM475279 465 20022248 Miwi IP adult testis
133 GSM475280 41 20022248 Mili IP adult testis
217 GSM1653802 53 25582079 MIWI CLIP round spermatids
225 GSM1528807 505 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 772 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1822 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1205 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 12 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 7 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 43 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 6 26115953 small RNA 25dpp homo tdrd6 KO testes
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 5 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 7 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 8 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 154 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 30 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 59 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 28 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 54 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 49 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 88 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
4 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:113336277-113336308:-
Location 2 6:128203338-128203369:-
Location 3 CHR_MG4259_PATCH:3054896-3054927:-
Location 4 X:51418207-51418238:+ Hs6st2 ENSMUST00000114871; Hs6st2 ENSMUST00000088172;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 2.8103
GSM433289 1.5312
GSM433290 9.1321
GSM433291 2.1344
GSM433292 31.8498
GSM433293 17.0152
GSM433294 0
GSM433295 0
GSM475279 44.6644
GSM475280 3.7277
GSM475281 9.1936
GSM678422 0
The Expression of piRNA: piR-mmu-81732
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Fam206a NM_001081420 cleavage mm9 chr4:56821998-56822018:+ n 25582079
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.