Loading...

Detail Information of piRNA: piR-mmu-8171

General Information
piRBase Id piR-mmu-8171 Accession DQ556247
Organism Mouse Number of methods 3
Sequence TGGTTCAGTAGTAGCTGTGAATGGAAGTC Number of papers 12
Length 29 Golden piRNA -
Aliases piR-23359; PIR17358;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
12 GSM822758 2 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
15 GSM822762 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 9 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 2 18922463 small RNA 4-6 week ovary
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 2 20439430 small RNA Mili-/- E16.5 testis
73 N/A 1 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 2 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
77 N/A 1 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
81 N/A 5 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 2 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 10 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 3 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 10 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 10 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 3 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 23 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
116 GSM958037 3 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 8 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 4 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 1 20022248 Mili IP adult testis
225 GSM1528807 10 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 17 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 17 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 4 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 4 26115953 small RNA 18dpp homo tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 1 20022248 Mili-IP testis 
347 GSM475281 3 20022248 small RNA testis 
348 GSM3772906 12 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 8 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 1 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 1 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
363 GSM2500215 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
441 GSM1096582 7 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 79 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 214 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 233 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 90 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 214 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 8 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 5 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 11 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 4 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 13 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 5 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
217 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:55067043-55067072:+ LINE L1 Lx2;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0.5154
GSM319958 3.2227
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 0.875
GSM433290 0
GSM433291 0.3557
GSM433292 0.2431
GSM433293 0.4254
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 0.0909
GSM475281 0.2814
GSM678422 0
The Expression of piRNA: piR-mmu-8171
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.