Loading...

Detail Information of piRNA: piR-mmu-80815

General Information
piRBase Id piR-mmu-80815 Accession N/A
Organism Mouse Number of methods 4
Sequence TAGAACTTGCAGAACATGGGCTATCCCCATCT Number of papers 7
Length 32 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 101 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 204 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 150 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 109 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 108 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 6 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 4 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 11 22842725 Miwi CLIP C57BL/6 adult testis
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
217 GSM1653802 26 25582079 MIWI CLIP round spermatids
234 GSM433288 3 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 4 26115953 small RNA 25dpp homo tdrd6 KO testes
356 GSM4635229 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
443 GSM1096583 19 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 28 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 30 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 36 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 46 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 41 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 155 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 93 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 146 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 105 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:59269964-59269996:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0.3344
GSM433288 0.7026
GSM433289 0.2187
GSM433290 0.6371
GSM433291 1.4229
GSM433292 1.7019
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0.0938
GSM678422 0
The Expression of piRNA: piR-mmu-80815
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.