Loading...

Detail Information of piRNA: piR-mmu-7770

General Information
piRBase Id piR-mmu-7770 Accession DQ555882
Organism Mouse Number of methods 3
Sequence TGGTGACTCTAGATAACCTCGGGCCGATC Number of papers 13
Length 29 Golden piRNA -
Aliases piR-22994; PIR16993;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
57 GSM319953 3 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 7 18922463 Mili IP 10 dpp Dnmt3L KO testis
62 GSM319958 1 18922463 small RNA 4-6 week ovary
72 GSM179088 3 17446352 Mili IP 10 dpp testis
73 N/A 42 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 15 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 3 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 13 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 8 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 2 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 3 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
81 N/A 4 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 9 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 7 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 3 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 22 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 19 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 13 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 41 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
116 GSM958037 2 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 4 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 19 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
121 GSM545783 2 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 7 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 5 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 3 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 6 20059948 Mili IP Tdrd9-/- 14dpp testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 3 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 3 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 5 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 7 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 7 25262350 small RNA E16.5 whole testes
247 GSM1318060 6 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
348 GSM3772906 8 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 20 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 12 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 9 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 9 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 11 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 86 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 136 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 78 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 113 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 3 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 3 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 7 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 6 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 6 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:39846646-39846675:+ CT010467.1 ENSMUST00000198477;
piRNA Expression
Sample CPM
GSM179088 16.5958
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 2.2613
GSM319954 3.2544
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 1.6113
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 1.6721
GSM433288 0
GSM433289 0.4375
GSM433290 0.6371
GSM433291 0.3557
GSM433292 0.2431
GSM433293 0
GSM433294 1.6426
GSM433295 0.7135
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.0531
The Expression of piRNA: piR-mmu-7770
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.