Loading...

Detail Information of piRNA: piR-mmu-7755

General Information
piRBase Id piR-mmu-7755 Accession DQ540587
Organism Mouse Number of methods 3
Sequence CAGAGTGAGTTCCAGGACAGCCAGGGC Number of papers 14
Length 27 Golden piRNA -
Aliases piR-699; PIR1698;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
16 GSM822763 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 34 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 4 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 53 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 14 18922463 Mili IP 10 dpp Dnmt3L KO testis
61 GSM319957 2 18922463 Miwi2 IP 16.5 dpc testis
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
71 GSM509280 20 20439430 small RNA MitoPLD-/- 10 dpp testis
72 GSM179088 1 17446352 Mili IP 10 dpp testis
74 N/A 10 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 27 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 7 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 45 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 2 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 3 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 20 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 4 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 5 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 5 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
85 N/A 3 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 32 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 25 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
114 GSM958035 6 22902560 Mili IP Fkbp6 +/-,P0,testis
116 GSM958037 105 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 13 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 1 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 2 20022248 Miwi IP adult testis
133 GSM475280 1 20022248 Mili IP adult testis
224 GSM1528806 1 26588211 small RNA 10dpp testes
228 GSM1528810 1 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 2 20022248 Miwi-IP testis 
346 GSM475280 1 20022248 Mili-IP testis 
348 GSM3772906 10 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 22 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 10 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 17 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 17 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 12 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 6 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 1059 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 202 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 886 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 143 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1455 23523368 oxidized small RNA Wild Type 14.5 dpp testes
448 GSM1096602 5 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 7 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 3 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
26353 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:96177432-96177459:+ Tafa1 ENSMUST00000122120; Tafa1 ENSMUST00000075080; LINE L1 Lx;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 5.5319
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 39.9504
GSM319954 6.5087
GSM319955 0
GSM319956 0
GSM319957 1.0308
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 0.2187
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 0.1921
GSM475280 0.0909
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-7755
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.