Loading...

Detail Information of piRNA: piR-mmu-756141

General Information
piRBase Id piR-mmu-756141 Accession N/A
Organism Mouse Number of methods 3
Sequence AGTTCGAGGACAGCCTGGTCTACACATTTT Number of papers 12
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
62 GSM319958 11 18922463 small RNA 4-6 week ovary
73 N/A 1 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 1 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
78 N/A 1 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
82 N/A 1 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 1 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
86 N/A 2 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
116 GSM958037 5 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 4 20022248 Mili IP adult testis
217 GSM1653802 2 25582079 MIWI CLIP round spermatids
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
228 GSM1528810 1 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 4 26115953 small RNA 18dpp homo tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
246 GSM1318059 4 25262350 small RNA E16.5 whole testes
247 GSM1318060 4 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 4 20022248 Mili-IP testis 
348 GSM3772906 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 6 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 5 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 3 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
354 GSM4635227 8 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
355 GSM4635228 7 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
356 GSM4635229 26 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
357 GSM4635230 5 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
358 GSM4635231 8 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
359 GSM4635232 4 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
445 GSM1096584 12 23523368 small RNA Wild Type 14.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
4 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:128760709-128760739:-
Location 2 6:128764131-128764161:- LINE L1 Lx8b;
Location 3 6:128803016-128803046:- Gm44511 ENSMUST00000204423; Gm44511 ENSMUST00000204394; Gm44511 ENSMUST00000204756; Gm44511 ENSMUST00000204677;
Location 4 6:128838512-128838542:+ LTR ERVK RLTR45-int;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 17.7248
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0.875
GSM433290 0
GSM433291 0.3557
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 0.3637
GSM475281 0
GSM678422 2.1224
The Expression of piRNA: piR-mmu-756141
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.