Loading...

Detail Information of piRNA: piR-mmu-745

General Information
piRBase Id piR-mmu-745 Accession DQ549492
Organism Mouse Number of methods 4
Sequence TGCATGTCTCACATCTGATTGGTTATACTC Number of papers 11
Length 30 Golden piRNA -
Aliases piR-17604; PIR10603;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 10 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 3 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
32 GSM684625 6 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 10 22842725 Miwi CLIP C57BL/6 adult testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
120 GSM958041 2 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
225 GSM1528807 4 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 10 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 23 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 10 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 4 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 4 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 4 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
348 GSM3772906 15 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 39 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 18 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 5 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 3 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 7 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 9 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 4 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 5 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 5 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 6 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1112 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:145499182-145499212:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.9368
GSM433289 0.2187
GSM433290 0.8495
GSM433291 1.4229
GSM433292 0
GSM433293 0.8508
GSM433294 0.2347
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-745
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.