Loading...

Detail Information of piRNA: piR-mmu-73048

General Information
piRBase Id piR-mmu-73048 Accession N/A
Organism Mouse Number of methods 4
Sequence ACTCGAGACTGTGTAGAACCTTCATAGGCTT Number of papers 11
Length 31 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 11814 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 6698 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 8016 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 787 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 725 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 3918 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1021 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 40 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 14 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 4 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 14 22842725 Miwi CLIP C57BL/6 adult testis
36 GSM684621 26 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 132 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 276 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 6 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 1 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 4 20439430 small RNA Mili-/- E16.5 testis
121 GSM545783 7 20534472 Mov10L1 IP wild type adult testis
217 GSM1653802 169 25582079 MIWI CLIP round spermatids
225 GSM1528807 135 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 611 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 899 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 122 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 96 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 168 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 157 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 31 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 176 26115953 small RNA 6 weeks hetero tdrd6 KO testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
355 GSM4635228 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
441 GSM1096582 158 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 67 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 140 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 720 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 752 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 904 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 746 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 500 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 582 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 863 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 981 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:74658065-74658096:+ LTR ERVL-MaLR ORR1G;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 1.864
Sample CPM
GSM400968 0
GSM400969 0.3344
GSM433288 22.4822
GSM433289 36.7485
GSM433290 33.3427
GSM433291 11.0275
GSM433292 42.7906
GSM433293 33.6051
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-73048
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.