Loading...
| piRBase Id | piR-mmu-72664 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 5 |
| Sequence | AAACCGTTACCATTACTGAGTTTAGT | Number of papers | 12 |
| Length | 26 | Golden piRNA | Y |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 6 | GSM113695 | 1 | 16778019 | Chromatography | testes tissue from Swiss Webster male mice, 8-10 weeks old |
| 50 | GSM610965 | 1 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
| 59 | GSM319955 | 3104 | 18922463 | small RNA | 16.5 dpc testis |
| 60 | GSM319956 | 7 | 18922463 | Mili IP | 16.5 dpc testis |
| 61 | GSM319957 | 310 | 18922463 | Miwi2 IP | 16.5 dpc testis |
| 62 | GSM319958 | 38 | 18922463 | small RNA | 4-6 week ovary |
| 63 | GSM319959 | 936 | 18922463 | small RNA | 2 dpp testis |
| 64 | GSM319960 | 851 | 18922463 | small RNA | 10 dpp testis |
| 65 | GSM319961 | 1292 | 18922463 | small RNA | 10 dpp MILI KO testis |
| 74 | N/A | 4 | 22020280 | Mili IP | Mili_MiliDAH_2 E16.5 fetal testis |
| 75 | N/A | 1 | 22020280 | Mili IP | Miwi2DAH_1 E16.5 fetal testis |
| 79 | N/A | 2 | 22020280 | Mili IP | Miwi2-/-_1 E16.5 fetal testis |
| 81 | N/A | 2 | 22020280 | Mili IP | wild_type_1 E16.5 fetal testis |
| 83 | N/A | 7 | 22020280 | Miwi2 IP | MiliDAH_1 E16.5 fetal testis |
| 84 | N/A | 6 | 22020280 | Miwi2 IP | MiliDAH_2 E16.5 fetal testis |
| 85 | N/A | 3 | 22020280 | Miwi2 IP | Miwi2DAH_1 E16.5 fetal testis |
| 86 | N/A | 7 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
| 87 | N/A | 4 | 22020280 | Miwi2 IP | wild_type_1 E16.5 fetal testis |
| 88 | N/A | 1 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
| 114 | GSM958035 | 3 | 22902560 | Mili IP | Fkbp6 +/-,P0,testis |
| 115 | GSM958036 | 8 | 22902560 | Mili IP | Fkbp6 -/-,P0,testis |
| 116 | GSM958037 | 1 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
| 118 | GSM958039 | 18 | 22902560 | Mili IP | Tdrd1 +/-,E18,testis |
| 119 | GSM958040 | 8 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
| 120 | GSM958041 | 6 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
| 132 | GSM475279 | 46 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 34 | 20022248 | Mili IP | adult testis |
| 217 | GSM1653802 | 22 | 25582079 | MIWI CLIP | round spermatids |
| 224 | GSM1528806 | 8027 | 26588211 | small RNA | 10dpp testes |
| 225 | GSM1528807 | 3737 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 4224 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 2829 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 2476 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 86 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 20 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 21 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 24 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 238 | GSM433292 | 8 | 26115953 | small RNA | 6 weeks hetero tdrd6 KO testes |
| 239 | GSM433293 | 4 | 26115953 | small RNA | 6 weeks homo tdrd6 KO testes |
| 240 | GSM433294 | 726 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
| 241 | GSM433295 | 1094 | 26115953 | small RNA | 18.5dpc homo tdrd1 KO testes |
| 246 | GSM1318059 | 105 | 25262350 | small RNA | E16.5 whole testes |
| 247 | GSM1318060 | 94 | 25262350 | small RNA | E16.5 whole testes Hsp90-alpha KO |
| 345 | GSM475279 | 46 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 34 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 1281 | 20022248 | small RNA | testis |
| 348 | GSM3772906 | 212 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
| 349 | GSM3772907 | 94 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
| 350 | GSM3772908 | 218 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
| 351 | GSM3772909 | 198 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 352 | GSM3772910 | 147 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 353 | GSM3772911 | 78 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 441 | GSM1096582 | 145 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 67 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 190 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 30 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 35 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 3 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 122 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 56 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 2 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 11:78073185-78073211:+ | Mir451b ENSMUST00000196157; Mir451a ENSMUST00000093557; | SINE B2 B2_Mm2; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 33.7873 |
| GSM261958 | 48.5021 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 1883.5431 |
| GSM319956 | 14.8413 |
| GSM319957 | 159.7681 |
| GSM319958 | 61.2313 |
| GSM319959 | 639.2919 |
| GSM319960 | 424.7153 |
| GSM319961 | 2650.9198 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 20.1403 |
| GSM433289 | 4.3748 |
| GSM433290 | 4.4598 |
| GSM433291 | 8.5375 |
| GSM433292 | 1.945 |
| GSM433293 | 1.7015 |
| GSM433294 | 170.3562 |
| GSM433295 | 260.1933 |
| GSM475279 | 4.4184 |
| GSM475280 | 3.0913 |
| GSM475281 | 120.174 |
| GSM678422 | 0.6367 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16778019 | Journal | Science. 2006 Jul 21;313(5785):363-7. |
|---|---|---|---|
| Title | Characterization of the piRNA complex from rat testes. | ||
| Authors | Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
|---|---|---|---|
| Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
| Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. | ||
| PubMed | 32674113 | Journal | Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5. |
|---|---|---|---|
| Title | SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation. | ||
| Authors | Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||