Loading...

Detail Information of piRNA: piR-mmu-72664

General Information
piRBase Id piR-mmu-72664 Accession N/A
Organism Mouse Number of methods 5
Sequence AAACCGTTACCATTACTGAGTTTAGT Number of papers 12
Length 26 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
59 GSM319955 3104 18922463 small RNA 16.5 dpc testis
60 GSM319956 7 18922463 Mili IP 16.5 dpc testis
61 GSM319957 310 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 38 18922463 small RNA 4-6 week ovary
63 GSM319959 936 18922463 small RNA 2 dpp testis
64 GSM319960 851 18922463 small RNA 10 dpp testis
65 GSM319961 1292 18922463 small RNA 10 dpp MILI KO testis
74 N/A 4 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 1 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
79 N/A 2 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
81 N/A 2 22020280 Mili IP wild_type_1 E16.5 fetal testis
83 N/A 7 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 6 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 3 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 7 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 4 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 3 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 8 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
118 GSM958039 18 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 8 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 6 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 46 20022248 Miwi IP adult testis
133 GSM475280 34 20022248 Mili IP adult testis
217 GSM1653802 22 25582079 MIWI CLIP round spermatids
224 GSM1528806 8027 26588211 small RNA 10dpp testes
225 GSM1528807 3737 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 4224 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 2829 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 2476 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 86 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 20 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 21 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 24 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 8 26115953 small RNA 6 weeks hetero tdrd6 KO testes
239 GSM433293 4 26115953 small RNA 6 weeks homo tdrd6 KO testes
240 GSM433294 726 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
241 GSM433295 1094 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 105 25262350 small RNA E16.5 whole testes
247 GSM1318060 94 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 46 20022248 Miwi-IP testis 
346 GSM475280 34 20022248 Mili-IP testis 
347 GSM475281 1281 20022248 small RNA testis 
348 GSM3772906 212 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 94 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 218 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 198 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 147 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 78 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 145 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 67 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 190 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 30 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 35 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 3 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 122 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 56 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 2 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 11:78073185-78073211:+ Mir451b ENSMUST00000196157; Mir451a ENSMUST00000093557; SINE B2 B2_Mm2;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 33.7873
GSM261958 48.5021
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 1883.5431
GSM319956 14.8413
GSM319957 159.7681
GSM319958 61.2313
GSM319959 639.2919
GSM319960 424.7153
GSM319961 2650.9198
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 20.1403
GSM433289 4.3748
GSM433290 4.4598
GSM433291 8.5375
GSM433292 1.945
GSM433293 1.7015
GSM433294 170.3562
GSM433295 260.1933
GSM475279 4.4184
GSM475280 3.0913
GSM475281 120.174
GSM678422 0.6367
The Expression of piRNA: piR-mmu-72664
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.