Loading...

Detail Information of piRNA: piR-mmu-72470

General Information
piRBase Id piR-mmu-72470 Accession N/A
Organism Mouse Number of methods 4
Sequence AGCTGGTGTTGTGAATCAGGCCG Number of papers 7
Length 23 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
57 GSM319953 5 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 3 18922463 Mili IP 10 dpp Dnmt3L KO testis
60 GSM319956 12 18922463 Mili IP 16.5 dpc testis
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
72 GSM179088 3 17446352 Mili IP 10 dpp testis
114 GSM958035 5 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 3 22902560 Mili IP Fkbp6 -/-,P0,testis
118 GSM958039 9 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 2 22902560 Mili IP Tdrd1 -/-,E18,testis
132 GSM475279 216 20022248 Miwi IP adult testis
133 GSM475280 45 20022248 Mili IP adult testis
355 GSM4635228 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
357 GSM4635230 2 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
358 GSM4635231 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
441 GSM1096582 605 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 9307 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 1817 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 385 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 7800 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 3334 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 68 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 4 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 266 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 15 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2538 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 31 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 8:94324311-94324334:+ C78859 ENSMUST00000212800; Mir138-2 ENSMUST00000083578;
Location 2 9:122682897-122682920:+ Gm47135 ENSMUST00000215737; Mir138-1 ENSMUST00000083480;
piRNA Expression
Sample CPM
GSM179088 16.5958
GSM261957 309.1856
GSM261958 1.6441
GSM261959 23.7804
GSM319953 3.7689
GSM319954 1.3947
GSM319955 674.7745
GSM319956 25.4422
GSM319957 0.5154
GSM319958 58.0086
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 17.7984
GSM433289 50.0917
GSM433290 15.7157
GSM433291 5.3359
GSM433292 93.8475
GSM433293 37.0082
GSM433294 143.3714
GSM433295 373.6413
GSM475279 20.7473
GSM475280 4.0914
GSM475281 56.6629
GSM678422 0.7959
The Expression of piRNA: piR-mmu-72470
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.