Loading...
| piRBase Id | piR-mmu-7143 | Accession | DQ555298 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGGGTGTCCGCTATTGTCCTGAGGCCTGA | Number of papers | 5 |
| Length | 29 | Golden piRNA | - |
| Aliases | piR-22410; PIR16409; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 61 | GSM319957 | 1 | 18922463 | Miwi2 IP | 16.5 dpc testis |
| 62 | GSM319958 | 1 | 18922463 | small RNA | 4-6 week ovary |
| 80 | N/A | 1 | 22020280 | Mili IP | Miwi2-/-_2 E16.5 fetal testis |
| 120 | GSM958041 | 1 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
| 452 | GSM1096604 | 1 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 11:60638073-60638102:+ | SINE B2 B2_Mm2; | |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 1.6441 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0.5154 |
| GSM319958 | 1.6113 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0 |
| GSM433289 | 0 |
| GSM433290 | 0 |
| GSM433291 | 0 |
| GSM433292 | 0 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||