Loading...

Detail Information of piRNA: piR-mmu-6919

General Information
piRBase Id piR-mmu-6919 Accession DQ555094
Organism Mouse Number of methods 2
Sequence TGGGGGGCCCAAGTCCTTCTGATCGAGGCCCA Number of papers 7
Length 32 Golden piRNA -
Aliases piR-22206; PIR16205;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
50 GSM610965 4 21602304 small RNA Male germ cell, Type A spermatogonia
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
122 N/A 3439 21515829 small RNA hippocampus
234 GSM433288 6 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 32 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 5 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 5 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 23 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 5 25262350 small RNA E16.5 whole testes
247 GSM1318060 3 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
442 GSM1096599 574 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 2969 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 64 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 2555 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 6864 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 24 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 116 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 191 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 3 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:146261023-146261055:+ Cdk8 ENSMUST00000162494; Cdk8 ENSMUST00000161181; Cdk8 ENSMUST00000031640; Cdk8 ENSMUST00000161652; Cdk8 ENSMUST00000159467;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 13.1531
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0.6068
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 1.4051
GSM433289 6.9997
GSM433290 1.0619
GSM433291 1.7786
GSM433292 4.1332
GSM433293 5.53
GSM433294 5.397
GSM433295 4.7567
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.0531
The Expression of piRNA: piR-mmu-6919
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.