Loading...

Detail Information of piRNA: piR-mmu-6918

General Information
piRBase Id piR-mmu-6918 Accession DQ555093
Organism Mouse Number of methods 3
Sequence TGGGGGGCCCAAGTCCTTCTGATCGAGGC Number of papers 13
Length 29 Golden piRNA -
Aliases piR-22205; PIR16204;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
50 GSM610965 11 21602304 small RNA Male germ cell, Type A spermatogonia
52 GSM610967 5 21602304 small RNA Male germ cell, Round spermatids
61 GSM319957 5 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 121 18922463 small RNA 4-6 week ovary
73 N/A 2 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
76 N/A 2 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
79 N/A 2 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
81 N/A 2 22020280 Mili IP wild_type_1 E16.5 fetal testis
88 N/A 2 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
122 N/A 775 21515829 small RNA hippocampus
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 19 20022248 Miwi IP adult testis
133 GSM475280 6 20022248 Mili IP adult testis
225 GSM1528807 19 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 30 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 41 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 45 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 4 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
240 GSM433294 11 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 63 25262350 small RNA E16.5 whole testes
247 GSM1318060 38 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 19 20022248 Miwi-IP testis 
346 GSM475280 6 20022248 Mili-IP testis 
347 GSM475281 4 20022248 small RNA testis 
348 GSM3772906 3 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 8 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 7 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 157 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 188 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 63 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 71 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 182 23523368 oxidized small RNA Wild Type 14.5 dpp testes
449 GSM1096586 8 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 30 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:146261023-146261052:+ Cdk8 ENSMUST00000162494; Cdk8 ENSMUST00000161181; Cdk8 ENSMUST00000031640; Cdk8 ENSMUST00000161652; Cdk8 ENSMUST00000159467;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0.8221
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 2.5769
GSM319958 194.9732
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 0.875
GSM433290 0.6371
GSM433291 0
GSM433292 1.4588
GSM433293 1.7015
GSM433294 2.5812
GSM433295 0.4757
GSM475279 1.825
GSM475280 0.5455
GSM475281 0.3753
GSM678422 8.3303
The Expression of piRNA: piR-mmu-6918
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.