Loading...

Detail Information of piRNA: piR-mmu-6746

General Information
piRBase Id piR-mmu-6746 Accession DQ716114
Organism Mouse Number of methods 5
Sequence TGGGATTATAGGCATATACAACTCGTGGCA Number of papers 13
Length 30 Golden piRNA -
Aliases piR-22034; piR-131436; PIR16033; PIR224762;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 6159 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 8261 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 3922 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 787 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 47 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 602 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 126 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 37 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 9 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 169 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 150 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 27 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 2 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 17 20439430 small RNA Mili-/- E16.5 testis
70 GSM509279 1 20439430 small RNA MVH-/- E16.5 testis
71 GSM509280 2 20439430 small RNA MitoPLD-/- 10 dpp testis
120 GSM958041 1 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
121 GSM545783 21 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
217 GSM1653802 86 25582079 MIWI CLIP round spermatids
224 GSM1528806 4 26588211 small RNA 10dpp testes
225 GSM1528807 383 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 602 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1231 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 511 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 36 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 28 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 50 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 8 26115953 small RNA 25dpp homo tdrd6 KO testes
441 GSM1096582 57 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 623 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 47 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1802 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 919 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 411 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 95 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 476 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 148 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 454 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 104 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27295997-27296027:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 6.2133
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 8.4308
GSM433289 6.1247
GSM433290 10.6187
GSM433291 2.8458
GSM433292 6.8076
GSM433293 8.933
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.0531
The Expression of piRNA: piR-mmu-6746
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.