Loading...
| piRBase Id | piR-mmu-670648 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | GAGGATCACGAGTTCGAGGCCAGCCTGGGC | Number of papers | 9 |
| Length | 30 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 12 | GSM822758 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 13 | GSM822759 | 3 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
| 32 | GSM684625 | 6 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 52 | GSM610967 | 6 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 85 | N/A | 1 | 22020280 | Miwi2 IP | Miwi2DAH_1 E16.5 fetal testis |
| 86 | N/A | 1 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
| 132 | GSM475279 | 2 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 3 | 20022248 | Mili IP | adult testis |
| 225 | GSM1528807 | 2 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 2 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 8 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 4 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 1 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 5 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 1 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 345 | GSM475279 | 2 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 3 | 20022248 | Mili-IP | testis |
| 354 | GSM4635227 | 3 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male) |
| 355 | GSM4635228 | 7 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male) |
| 356 | GSM4635229 | 7 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male) |
| 357 | GSM4635230 | 15 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation) |
| 358 | GSM4635231 | 2 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation) |
| 359 | GSM4635232 | 5 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation) |
| 450 | GSM1096603 | 1 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 4:132281364-132281394:+ | Taf12 ENSMUST00000030731; Taf12 ENSMUST00000105963; | |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0.2342 |
| GSM433289 | 1.0937 |
| GSM433290 | 0.2124 |
| GSM433291 | 0 |
| GSM433292 | 0.4863 |
| GSM433293 | 0.8508 |
| GSM433294 | 0 |
| GSM433295 | 0.2378 |
| GSM475279 | 0.1921 |
| GSM475280 | 0.2728 |
| GSM475281 | 0 |
| GSM678422 | 0.1592 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 33184219 | Journal | Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12. |
|---|---|---|---|
| Title | Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline. | ||
| Authors | Bloom JC, Schimenti JC. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||