Loading...

Detail Information of piRNA: piR-mmu-6695

General Information
piRBase Id piR-mmu-6695 Accession DQ554876
Organism Mouse Number of methods 3
Sequence TGGGATTAAAGGTGCAAACTACCACGC Number of papers 11
Length 27 Golden piRNA -
Aliases piR-21988; PIR15987;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
50 GSM610965 7 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 13 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 14 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
60 GSM319956 1 18922463 Mili IP 16.5 dpc testis
71 GSM509280 5 20439430 small RNA MitoPLD-/- 10 dpp testis
72 GSM179088 1 17446352 Mili IP 10 dpp testis
126 GSM466728 16 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 16 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 2 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 2 20059948 Mili IP Tdrd9-/- 14dpp testis
133 GSM475280 1 20022248 Mili IP adult testis
224 GSM1528806 27 26588211 small RNA 10dpp testes
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
346 GSM475280 1 20022248 Mili-IP testis 
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 703 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 15 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 55 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 36 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 459 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 2 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 5 23523368 oxidized small RNA Wild Type 17.5 dpp testes
450 GSM1096603 7 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 3 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:52164831-52164858:- Gls ENSMUST00000114513; DNA hAT-Charlie RCHARR1;
piRNA Expression
Sample CPM
GSM179088 5.5319
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 9.7992
GSM319954 6.5087
GSM319955 0.6068
GSM319956 2.1202
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 0.4375
GSM433290 0
GSM433291 0.3557
GSM433292 0.2431
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0.0909
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-6695
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.