Loading...
| piRBase Id | piR-mmu-669354 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | GAAGGAGGCAGAGGCAGGAGGATCACGA | Number of papers | 7 |
| Length | 28 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 12 | GSM822758 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 14 | GSM822761 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 16 | GSM822763 | 22 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 32 | GSM684625 | 6 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 73 | N/A | 4 | 22020280 | Mili IP | Mili_MiliDAH_1 E16.5 fetal testis |
| 75 | N/A | 1 | 22020280 | Mili IP | Miwi2DAH_1 E16.5 fetal testis |
| 79 | N/A | 5 | 22020280 | Mili IP | Miwi2-/-_1 E16.5 fetal testis |
| 83 | N/A | 2 | 22020280 | Miwi2 IP | MiliDAH_1 E16.5 fetal testis |
| 84 | N/A | 3 | 22020280 | Miwi2 IP | MiliDAH_2 E16.5 fetal testis |
| 86 | N/A | 18 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
| 87 | N/A | 1 | 22020280 | Miwi2 IP | wild_type_1 E16.5 fetal testis |
| 88 | N/A | 5 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
| 116 | GSM958037 | 2 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
| 133 | GSM475280 | 1 | 20022248 | Mili IP | adult testis |
| 225 | GSM1528807 | 1 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 346 | GSM475280 | 1 | 20022248 | Mili-IP | testis |
| 357 | GSM4635230 | 1 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation) |
| 358 | GSM4635231 | 1 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation) |
| 359 | GSM4635232 | 1 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation) |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 16:13369138-13369166:- | Mrtfb ENSMUST00000009713; Gm15738 ENSMUST00000210378; Mrtfb ENSMUST00000149359; | LTR ERVL-MaLR ORR1A3-int; |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0 |
| GSM433289 | 0 |
| GSM433290 | 0 |
| GSM433291 | 0 |
| GSM433292 | 0 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0.0909 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 33184219 | Journal | Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12. |
|---|---|---|---|
| Title | Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline. | ||
| Authors | Bloom JC, Schimenti JC. | ||