Loading...
piRBase Id | piR-mmu-651 | Accession | DQ700418 |
---|---|---|---|
Organism | Mouse | Number of methods | 5 |
Sequence | TGCATATTGAAATGTTCTGGAACCTCGGT | Number of papers | 13 |
Length | 29 | Golden piRNA | - |
Aliases | piR-17519; piR-115740; PIR10518; PIR209066; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
6 | GSM113695 | 1 | 16778019 | Chromatography | testes tissue from Swiss Webster male mice, 8-10 weeks old |
11 | GSM822760 | 101 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
12 | GSM822758 | 58 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
13 | GSM822759 | 54 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
14 | GSM822761 | 147 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
15 | GSM822762 | 9 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
16 | GSM822763 | 55 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
17 | GSM822764 | 75 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
31 | GSM684624 | 44 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
32 | GSM684625 | 5 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
51 | GSM610966 | 2 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
52 | GSM610967 | 11 | 21602304 | small RNA | Male germ cell, Round spermatids |
116 | GSM958037 | 1 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
117 | GSM958038 | 1 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
120 | GSM958041 | 1 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
121 | GSM545783 | 4 | 20534472 | Mov10L1 IP | wild type adult testis |
126 | GSM466728 | 9 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
129 | GSM466729 | 9 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
132 | GSM475279 | 13 | 20022248 | Miwi IP | adult testis |
133 | GSM475280 | 11 | 20022248 | Mili IP | adult testis |
217 | GSM1653802 | 4 | 25582079 | MIWI CLIP | round spermatids |
225 | GSM1528807 | 5 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 4 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 13 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 20 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
234 | GSM433288 | 1 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
235 | GSM433289 | 1 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
236 | GSM433290 | 3 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
345 | GSM475279 | 13 | 20022248 | Miwi-IP | testis |
346 | GSM475280 | 11 | 20022248 | Mili-IP | testis |
347 | GSM475281 | 3 | 20022248 | small RNA | testis |
441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
443 | GSM1096583 | 12 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
444 | GSM1096600 | 9 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 23 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 49 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
447 | GSM1096585 | 2 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
448 | GSM1096602 | 7 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
449 | GSM1096586 | 11 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 17 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 2 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
452 | GSM1096604 | 12 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 4:62220718-62220747:- | Zfp37 ENSMUST00000212325; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 3.3441 |
GSM433288 | 0.2342 |
GSM433289 | 0.2187 |
GSM433290 | 0.6371 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0.8508 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 1.2487 |
GSM475280 | 1.0001 |
GSM475281 | 0.2814 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 16778019 | Journal | Science. 2006 Jul 21;313(5785):363-7. |
---|---|---|---|
Title | Characterization of the piRNA complex from rat testes. | ||
Authors | Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
---|---|---|---|
Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
---|---|---|---|
Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. |
PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
---|---|---|---|
Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
---|---|---|---|
Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |