Loading...

Detail Information of piRNA: piR-mmu-644

General Information
piRBase Id piR-mmu-644 Accession DQ549400
Organism Mouse Number of methods 4
Sequence TGCATATGTCTGGTGTTCAGTGACTGTC Number of papers 10
Length 28 Golden piRNA -
Aliases piR-17512; PIR10511;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
16 GSM822763 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 4 22842725 Miwi CLIP C57BL/6 adult testis
52 GSM610967 3 21602304 small RNA Male germ cell, Round spermatids
74 N/A 3 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
86 N/A 3 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 8 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 1 20022248 Mili IP adult testis
217 GSM1653802 21 25582079 MIWI CLIP round spermatids
225 GSM1528807 6 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 10 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 7 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 8 26588211 small RNA Adult testes Asb1 ao36(KO)
236 GSM433290 2 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 1 20022248 Mili-IP testis 
347 GSM475281 1 20022248 small RNA testis 
446 GSM1096601 7 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 4 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 4 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 3 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 4 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:128445330-128445358:+ Gm10069 ENSMUST00000144745; Gm10069 ENSMUST00000204081; SINE B4 ID_B1;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0.4247
GSM433291 0.3557
GSM433292 0.7294
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 0.0909
GSM475281 0.0938
GSM678422 0
The Expression of piRNA: piR-mmu-644
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.