Loading...

Detail Information of piRNA: piR-mmu-641

General Information
piRBase Id piR-mmu-641 Accession DQ549398
Organism Mouse Number of methods 3
Sequence TGCATATGACCGTTTGCCTGCACGTGCAC Number of papers 8
Length 29 Golden piRNA -
Aliases piR-17510; PIR10509;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 5 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 8 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
116 GSM958037 4 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 1 22902560 Mili IP Tdrd1 +/-,E18,testis
120 GSM958041 1 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
126 GSM466728 13 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 9 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 7 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 3 20059948 Mili IP Tdrd9-/- 14dpp testis
133 GSM475280 1 20022248 Mili IP adult testis
225 GSM1528807 2 26588211 small RNA Adult testes Asb1 ao31(Het)
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
346 GSM475280 1 20022248 Mili-IP testis 
442 GSM1096599 80 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 3 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 7 23523368 small RNA Wild Type 14.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 8:107016074-107016103:+ Sntb2 ENSMUST00000212524;
piRNA Expression
The Expression of piRNA: piR-mmu-641
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.