Loading...
| piRBase Id | piR-mmu-6363 | Accession | AB251128 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | TGGGAGAATTTAGAAAGGCAAGGTGCAGG | Number of papers | 9 |
| Length | 29 | Golden piRNA | - |
| Aliases | piR-21788; PIR15787; gsRNA158; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 10 | N/A | N/A | 16766680 | small RNA | testis |
| 11 | GSM822760 | 21 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 12 | GSM822758 | 67 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 13 | GSM822759 | 26 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
| 14 | GSM822761 | 44 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 15 | GSM822762 | 14 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 16 | GSM822763 | 4 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 17 | GSM822764 | 29 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 31 | GSM684624 | 10 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 121 | GSM545783 | 2 | 20534472 | Mov10L1 IP | wild type adult testis |
| 132 | GSM475279 | 23 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 3 | 20022248 | Mili IP | adult testis |
| 225 | GSM1528807 | 10 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 20 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 14 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 9 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 1 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 1 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 1 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 345 | GSM475279 | 23 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 3 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 7 | 20022248 | small RNA | testis |
| 441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 19 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 23 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 27 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 143 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 7 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 17 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 10 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 15 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 7 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 22 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 7:73780191-73780220:- |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0.2342 |
| GSM433289 | 0.2187 |
| GSM433290 | 0.2124 |
| GSM433291 | 0 |
| GSM433292 | 0.4863 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 2.2092 |
| GSM475280 | 0.2728 |
| GSM475281 | 0.6567 |
| GSM678422 | 0.0531 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 16766680 | Journal | Genes Dev. 2006 Jul 1;20(13):1709-14. |
|---|---|---|---|
| Title | A novel class of small RNAs in mouse spermatogenic cells. | ||
| Authors | Grivna ST, Beyret E, Wang Z, Lin H. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
|---|---|---|---|
| Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
| Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||