Loading...

Detail Information of piRNA: piR-mmu-6329

General Information
piRBase Id piR-mmu-6329 Accession DQ554645
Organism Mouse Number of methods 3
Sequence TGGGACTCGTATTACAGGGAATGGCA Number of papers 11
Length 26 Golden piRNA -
Aliases piR-21757; PIR15756;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
50 GSM610965 7 21602304 small RNA Male germ cell, Type A spermatogonia
63 GSM319959 1 18922463 small RNA 2 dpp testis
64 GSM319960 8 18922463 small RNA 10 dpp testis
74 N/A 1 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 1 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 3 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
80 N/A 1 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 6 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 1 22020280 Mili IP wild_type_2 E16.5 fetal testis
114 GSM958035 2 22902560 Mili IP Fkbp6 +/-,P0,testis
116 GSM958037 25 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 16 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 4 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 5 22902560 Mili IP Tdrd1 -/-,E18,testis
121 GSM545783 3 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 51 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 63 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 25 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 27 20059948 Mili IP Tdrd9-/- 14dpp testis
133 GSM475280 2 20022248 Mili IP adult testis
224 GSM1528806 19 26588211 small RNA 10dpp testes
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 2 26588211 small RNA Adult testes Asb1 ao32(KO)
346 GSM475280 2 20022248 Mili-IP testis 
443 GSM1096583 10 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 49 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 9 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 34 23523368 oxidized small RNA Wild Type 14.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:153229377-153229403:- Plagl2 ENSMUST00000056924; Plagl2 ENSMUST00000109795; SINE B2 B3;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0.683
GSM319960 3.9926
GSM319961 0
GSM400967 2.4853
Sample CPM
GSM400968 3.9079
GSM400969 7.0227
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0.1818
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-6329
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.