Loading...

Detail Information of piRNA: piR-mmu-630526

General Information
piRBase Id piR-mmu-630526 Accession N/A
Organism Mouse Number of methods 3
Sequence AATACATCTAGTTGTATCTGGACAAGATCT Number of papers 12
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
12 GSM822758 4 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
59 GSM319955 5 18922463 small RNA 16.5 dpc testis
61 GSM319957 14 18922463 Miwi2 IP 16.5 dpc testis
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
69 GSM509278 10 20439430 small RNA Miwi2-/- E16.5 testis
73 N/A 1 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 1 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 23 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 9 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 4 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 7 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 2 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
81 N/A 71 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 6 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 6 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 11 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 28 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 86 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 30 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 34 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
116 GSM958037 3 22902560 Mili IP Fkbp6 +/-,P10,testis
120 GSM958041 3 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
133 GSM475280 1 20022248 Mili IP adult testis
225 GSM1528807 10 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 16 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 10 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 5 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 7 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 4 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 2 26115953 small RNA 6 weeks hetero tdrd6 KO testes
240 GSM433294 6 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 10 25262350 small RNA E16.5 whole testes
247 GSM1318060 7 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
346 GSM475280 1 20022248 Mili-IP testis 
348 GSM3772906 108 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 78 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 360 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 496 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 598 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 633 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
358 GSM4635231 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
441 GSM1096582 6 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 80 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 127 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 72 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 21 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 3 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 16 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 9 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1230 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 16:22981923-22981953:- LINE L1 L1_Mur3;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 3.0341
GSM319956 0
GSM319957 7.2153
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 1.6393
GSM433289 0.2187
GSM433290 0.6371
GSM433291 1.4229
GSM433292 0.4863
GSM433293 0.8508
GSM433294 1.4079
GSM433295 0.7135
GSM475279 0
GSM475280 0.0909
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-630526
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.