piRBase

piRBase Id	piR-mmu-630513	Accession	N/A
Organism	Mouse	Number of methods	3
Sequence	AAGTGGATAAGATGACCCGTTCTGTGGAC	Number of papers	7
Length	29	Golden piRNA	-
Aliases	N/A

Dataset	Accession	Reads	PubMed	Method	Tissue
12	GSM822758	4	22121019	Miwi IP	Testes, C57BL/6 P14 Miwi +/+
14	GSM822761	2	22121019	Miwi IP	Testes, C57BL/6 Adult Miwi +/ADH
15	GSM822762	3	22121019	Miwi IP	Testes, C57BL/6 Adult Miwi -/ADH
17	GSM822764	1	22121019	Miwi IP	Testes, C57BL/6 Adult Miwi -/ADH
79	N/A	4	22020280	Mili IP	Miwi2-/-_1 E16.5 fetal testis
85	N/A	1	22020280	Miwi2 IP	Miwi2DAH_1 E16.5 fetal testis
132	GSM475279	2	20022248	Miwi IP	adult testis
133	GSM475280	2	20022248	Mili IP	adult testis
224	GSM1528806	19	26588211	small RNA	10dpp testes
228	GSM1528810	2	26588211	small RNA	Adult testes Asb1 ao36(KO)
345	GSM475279	2	20022248	Miwi-IP	testis
346	GSM475280	2	20022248	Mili-IP	testis
347	GSM475281	4	20022248	small RNA	testis
356	GSM4635229	1	33184219	small RNA	primordial germ cells(age: E13.5; sex: male)
364	GSM2500216	N/A	31358756	samll RNA(CAS-seq)	oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
441	GSM1096582	1	23523368	small RNA	Wild Type 10.5 dpp testes
442	GSM1096599	1	23523368	oxidized small RNA	Wild Type 10.5 dpp testes
443	GSM1096583	1	23523368	small RNA	Wild Type 12.5 dpp testes
444	GSM1096600	28	23523368	oxidized small RNA	Wild Type 12.5 dpp testes
445	GSM1096584	14	23523368	small RNA	Wild Type 14.5 dpp testes
446	GSM1096601	45	23523368	oxidized small RNA	Wild Type 14.5 dpp testes
447	GSM1096585	1	23523368	small RNA	Wild Type 17.5 dpp testes
449	GSM1096586	2	23523368	small RNA	Wild Type 20.5 dpp testes

678 best hit(s) with 0 mismatch(es) in GRCm38

No.	Location	Gene	RepeatMaker
Location 1	11:76832618-76832647:+	Cpd ENSMUST00000021201;	DNA hAT-Charlie RCHARR1;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC

Loading...

Sample1

Sample2

No record.

No record.

No record.

No record.

PubMed	22121019	Journal	Nature. 2011 Nov 27;480(7376):264-7.
Title	Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors	Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.

PubMed	22020280	Journal	Nature. 2011 Oct 23;480(7376):259-63.
Title	The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors	De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.

PubMed	20022248	Journal	Curr Biol. 2009 Dec 29;19(24):2066-76.
Title	A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors	Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.

PubMed	26588211	Journal	PLoS Genet. 2015 Nov 20;11(11):e1005652
Title	Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors	Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.

PubMed	33184219	Journal	Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title	Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors	Bloom JC, Schimenti JC.

PubMed	31358756	Journal	Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title	Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors	Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.

PubMed	23523368	Journal	Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title	An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors	Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.

Detail Information of piRNA: piR-mmu-630513