Loading...

Detail Information of piRNA: piR-mmu-6273

General Information
piRBase Id piR-mmu-6273 Accession DQ554594
Organism Mouse Number of methods 4
Sequence TGGGAATTGAACTCAGGACCTCTGGAAGA Number of papers 13
Length 29 Golden piRNA Y
Aliases piR-21706; PIR15705;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 166 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1426 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 421 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1247 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 102 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 135 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 70 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 4 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 2 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 105 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 150 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 2 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 3 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 6 18922463 small RNA 16.5 dpc testis
61 GSM319957 8 18922463 Miwi2 IP 16.5 dpc testis
73 N/A 27 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 24 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 74 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 63 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 20 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 5 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 7 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 3 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 43 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 62 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 10 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 1 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 198 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 118 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 155 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 178 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 6 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 2 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 24 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 24 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 2 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 73 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 121 20022248 Miwi IP adult testis
133 GSM475280 10 20022248 Mili IP adult testis
225 GSM1528807 32 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 220 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 61 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 57 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 2 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 15 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 12 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 2 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 14 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 5 25262350 small RNA E16.5 whole testes
345 GSM475279 121 20022248 Miwi-IP testis 
346 GSM475280 10 20022248 Mili-IP testis 
347 GSM475281 36 20022248 small RNA testis 
348 GSM3772906 170 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 143 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 131 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 74 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 113 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 111 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 36 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 1198 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 1083 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 482 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 348 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 778 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 110 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 15 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 149 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 26 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 174 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 15 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
9451 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:110035021-110035050:+ SINE Alu B1_Mus1;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 1.5076
GSM319954 1.3947
GSM319955 3.6409
GSM319956 0
GSM319957 4.123
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.4684
GSM433289 3.2811
GSM433290 2.5485
GSM433291 0.7115
GSM433292 1.7019
GSM433293 0
GSM433294 3.2851
GSM433295 0
GSM475279 11.6223
GSM475280 0.9092
GSM475281 3.3773
GSM678422 0.2122
The Expression of piRNA: piR-mmu-6273
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Ankle2 NM_001253814 cleavage mm9 chr5:110684254-110684274:+ n 25582079
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
NONMMUT026488 cleavage mm9 chr16:36859520-36859540:+ n N/A
NONMMUT053937 cleavage mm9 chr5:113792569-113792589:+ n N/A
Target Network
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.