Loading...
| piRBase Id | piR-mmu-6246 | Accession | DQ554569 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | TGGGAATGGGAGTTGTCTACTTGTTCAAGT | Number of papers | 6 |
| Length | 30 | Golden piRNA | - |
| Aliases | piR-21681; PIR15680; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 132 | GSM475279 | 29 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 3 | 20022248 | Mili IP | adult testis |
| 217 | GSM1653802 | 34 | 25582079 | MIWI CLIP | round spermatids |
| 225 | GSM1528807 | 1 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 3 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 228 | GSM1528810 | 3 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 345 | GSM475279 | 29 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 3 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 24 | 20022248 | small RNA | testis |
| 354 | GSM4635227 | 1 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male) |
| 441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 3 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 1 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 450 | GSM1096603 | 3 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 2 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 3 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 2:151260434-151260464:- | ||
| Location 2 | 2:151320379-151320409:+ | LINE L1 L1MdF_IV; | |
| Location 3 | 2:151414001-151414031:- | Gm14152 ENSMUST00000127020; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0 |
| GSM433289 | 0 |
| GSM433290 | 0 |
| GSM433291 | 0 |
| GSM433292 | 0 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 2.7855 |
| GSM475280 | 0.2728 |
| GSM475281 | 2.2515 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 33184219 | Journal | Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12. |
|---|---|---|---|
| Title | Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline. | ||
| Authors | Bloom JC, Schimenti JC. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||