Loading...
piRBase Id | piR-mmu-623282 | Accession | N/A |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TGTGATTGTACAAATTCAGTATGGGCACCGCT | Number of papers | 5 |
Length | 32 | Golden piRNA | - |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
12 | GSM822758 | 7 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
13 | GSM822759 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
14 | GSM822761 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
69 | GSM509278 | 4 | 20439430 | small RNA | Miwi2-/- E16.5 testis |
246 | GSM1318059 | 3 | 25262350 | small RNA | E16.5 whole testes |
358 | GSM4635231 | 1 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation) |
446 | GSM1096601 | 14 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 2:86367234-86367266:- | ||
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
---|---|---|---|
Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. |
PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
---|---|---|---|
Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. |
PubMed | 33184219 | Journal | Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12. |
---|---|---|---|
Title | Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline. | ||
Authors | Bloom JC, Schimenti JC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |