Loading...

Detail Information of piRNA: piR-mmu-623282

General Information
piRBase Id piR-mmu-623282 Accession N/A
Organism Mouse Number of methods 3
Sequence TGTGATTGTACAAATTCAGTATGGGCACCGCT Number of papers 5
Length 32 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
12 GSM822758 7 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
69 GSM509278 4 20439430 small RNA Miwi2-/- E16.5 testis
246 GSM1318059 3 25262350 small RNA E16.5 whole testes
358 GSM4635231 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
446 GSM1096601 14 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
90 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:86367234-86367266:-
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.