Loading...

Detail Information of piRNA: piR-mmu-622368

General Information
piRBase Id piR-mmu-622368 Accession N/A
Organism Mouse Number of methods 3
Sequence GAAGGAGGCAGAGGCAGGAGGATCACGAG Number of papers 5
Length 29 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
12 GSM822758 7 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
16 GSM822763 28 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
78 N/A 1 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
116 GSM958037 2 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
355 GSM4635228 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
356 GSM4635229 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
446 GSM1096601 4 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
81 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 14:115997651-115997680:- Gpc5 ENSMUST00000176912; Gpc5 ENSMUST00000022707;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.