Loading...

Detail Information of piRNA: piR-mmu-6222

General Information
piRBase Id piR-mmu-6222 Accession DQ725751
Organism Mouse Number of methods 5
Sequence TGGGAATGAGGTTCAGGACACAGGGC Number of papers 14
Length 26 Golden piRNA Y
Aliases piR-21660; piR-141073; PIR15659; PIR234399;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
12 GSM822758 3 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 27 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
17 GSM822764 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 7 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 3 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 42 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 29 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
64 GSM319960 1 18922463 small RNA 10 dpp testis
65 GSM319961 1 18922463 small RNA 10 dpp MILI KO testis
66 GSM509275 3 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 16 20439430 small RNA Mili-/- E16.5 testis
71 GSM509280 1 20439430 small RNA MitoPLD-/- 10 dpp testis
121 GSM545783 607 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 42 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 47 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 30 20022248 Miwi IP adult testis
133 GSM475280 336 20022248 Mili IP adult testis
225 GSM1528807 153 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 139 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 256 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 263 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 84 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 269 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 128 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 20 26115953 small RNA 25dpp homo tdrd6 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
345 GSM475279 30 20022248 Miwi-IP testis 
346 GSM475280 336 20022248 Mili-IP testis 
347 GSM475281 64 20022248 small RNA testis 
441 GSM1096582 159 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 1134 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 2075 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1557 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 4611 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 163 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 617 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 338 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1145 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 201 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 440 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 7:73817263-73817289:+ Gm21269 ENSMUST00000206521; LINE L1 Lx8;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0.7538
GSM319954 0.4649
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0.4991
GSM319961 2.0518
GSM400967 319.9874
Sample CPM
GSM400968 101.9952
GSM400969 5.3506
GSM433288 19.6719
GSM433289 58.8413
GSM433290 27.1838
GSM433291 7.1145
GSM433292 20.1796
GSM433293 21.2691
GSM433294 0
GSM433295 0
GSM475279 2.8816
GSM475280 30.5492
GSM475281 6.004
GSM678422 0.2653
The Expression of piRNA: piR-mmu-6222
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.