Loading...

Detail Information of piRNA: piR-mmu-604706

General Information
piRBase Id piR-mmu-604706 Accession N/A
Organism Mouse Number of methods 4
Sequence TTTAATCCTAGCACTGGGGAGTTTAGAGGC Number of papers 8
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
31 GSM684624 2 22842725 Miwi CLIP C57BL/6 adult testis
71 GSM509280 1 20439430 small RNA MitoPLD-/- 10 dpp testis
116 GSM958037 4 22902560 Mili IP Fkbp6 +/-,P10,testis
131 GSM466731 3 20059948 Mili IP Tdrd9-/- 14dpp testis
133 GSM475280 1 20022248 Mili IP adult testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
346 GSM475280 1 20022248 Mili-IP testis 
347 GSM475281 1 20022248 small RNA testis 
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 21 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 5 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 74 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 31 23523368 oxidized small RNA Wild Type 14.5 dpp testes
448 GSM1096602 3 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 5 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
452 GSM1096604 2 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:168311101-168311131:-
piRNA Expression
The Expression of piRNA: piR-mmu-604706
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Polr3gl NM_027241 cleavage mm9 chr3:96382133-96382153:- n 25582079
Atad2 NM_027435 cleavage mm9 chr15:57926255-57926275:- n 25582079
Mdc1 NM_001010833 cleavage mm9 chr17:35995884-35995904:+ n 25582079
Rad1 NM_011232 cleavage mm9 chr15:10423219-10423239:+ n 25582079
Neu3 NM_016720 cleavage mm9 chr7:106960466-106960486:- n 25582079
Cwc25 NM_026186 cleavage mm9 chr11:97607092-97607112:- n 25582079
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
NONMMUT002538 cleavage mm9 chr1:132619500-132619520:+ n N/A
Gm11739 ENSMUST00000125269.1 NONMMUT012829 cleavage mm9 chr11:116335247-116335267:+ n N/A
NONMMUT021455 cleavage mm9 chr14:70558136-70558156:+ n N/A
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.