Loading...
piRBase Id | piR-mmu-604706 | Accession | N/A |
---|---|---|---|
Organism | Mouse | Number of methods | 4 |
Sequence | TTTAATCCTAGCACTGGGGAGTTTAGAGGC | Number of papers | 8 |
Length | 30 | Golden piRNA | - |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
11 | GSM822760 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
31 | GSM684624 | 2 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
71 | GSM509280 | 1 | 20439430 | small RNA | MitoPLD-/- 10 dpp testis |
116 | GSM958037 | 4 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
131 | GSM466731 | 3 | 20059948 | Mili IP | Tdrd9-/- 14dpp testis |
133 | GSM475280 | 1 | 20022248 | Mili IP | adult testis |
225 | GSM1528807 | 1 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 1 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 1 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
346 | GSM475280 | 1 | 20022248 | Mili-IP | testis |
347 | GSM475281 | 1 | 20022248 | small RNA | testis |
441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
442 | GSM1096599 | 21 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
443 | GSM1096583 | 5 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
444 | GSM1096600 | 74 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 1 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 31 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
448 | GSM1096602 | 3 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
449 | GSM1096586 | 5 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 1 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
452 | GSM1096604 | 2 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 2:168311101-168311131:- |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0.6688 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0.4254 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0.0909 |
GSM475281 | 0.0938 |
GSM678422 | 0 |
Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
---|---|---|---|---|---|
Polr3gl | NM_027241 | cleavage | mm9 chr3:96382133-96382153:- | n | 25582079 |
Atad2 | NM_027435 | cleavage | mm9 chr15:57926255-57926275:- | n | 25582079 |
Mdc1 | NM_001010833 | cleavage | mm9 chr17:35995884-35995904:+ | n | 25582079 |
Rad1 | NM_011232 | cleavage | mm9 chr15:10423219-10423239:+ | n | 25582079 |
Neu3 | NM_016720 | cleavage | mm9 chr7:106960466-106960486:- | n | 25582079 |
Cwc25 | NM_026186 | cleavage | mm9 chr11:97607092-97607112:- | n | 25582079 |
Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
---|---|---|---|---|---|
NONMMUT002538 | cleavage | mm9 chr1:132619500-132619520:+ | n | N/A | |
Gm11739 | ENSMUST00000125269.1 NONMMUT012829 | cleavage | mm9 chr11:116335247-116335267:+ | n | N/A |
NONMMUT021455 | cleavage | mm9 chr14:70558136-70558156:+ | n | N/A |
No record. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
---|---|---|---|
Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. |
PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
---|---|---|---|
Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
---|---|---|---|
Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |
PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
---|---|---|---|
Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. |