Loading...

Detail Information of piRNA: piR-mmu-604679

General Information
piRBase Id piR-mmu-604679 Accession N/A
Organism Mouse Number of methods 3
Sequence TTTAATCCCAGCACTCGGGAGGCAGAGGCA Number of papers 9
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
50 GSM610965 48 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 5 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 4 21602304 small RNA Male germ cell, Round spermatids
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
61 GSM319957 3 18922463 Miwi2 IP 16.5 dpc testis
80 N/A 1 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 1 22020280 Mili IP wild_type_1 E16.5 fetal testis
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
116 GSM958037 4 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
132 GSM475279 6 20022248 Miwi IP adult testis
133 GSM475280 2 20022248 Mili IP adult testis
224 GSM1528806 6 26588211 small RNA 10dpp testes
225 GSM1528807 28 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 64 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 64 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 21 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 5 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 5 26115953 small RNA 25dpp hetero tdrd6 KO testes
240 GSM433294 8 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
345 GSM475279 6 20022248 Miwi-IP testis 
346 GSM475280 2 20022248 Mili-IP testis 
347 GSM475281 11 20022248 small RNA testis 
441 GSM1096582 4 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 194 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 16 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 34 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 19 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 80 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 8 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 2 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 20 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 24 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
16627 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:151441582-151441612:- Trmt1l ENSMUST00000065625; Trmt1l ENSMUST00000188179; Trmt1l ENSMUST00000188843; Trmt1l ENSMUST00000189655; LINE L1 Lx6;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0.4649
GSM319955 0
GSM319956 0
GSM319957 1.5461
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 1.1709
GSM433289 0.4375
GSM433290 1.0619
GSM433291 0
GSM433292 0.9725
GSM433293 0.4254
GSM433294 1.8772
GSM433295 0
GSM475279 0.5763
GSM475280 0.1818
GSM475281 1.0319
GSM678422 0
The Expression of piRNA: piR-mmu-604679
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Exoc8 NM_198103 cleavage mm9 chr8:127417247-127417267:- n 25582079
Man2a2 NM_172903 cleavage mm9 chr7:87494537-87494557:- n 25582079
Polr3gl NM_027241 cleavage mm9 chr3:96382133-96382153:- n 25582079
Ttc26 NM_153600 cleavage mm9 chr6:38375673-38375693:+ n 25582079
Xrcc2 NM_020570 cleavage mm9 chr5:25196225-25196245:- n 25582079
Atad2 NM_027435 cleavage mm9 chr15:57926255-57926275:- n 25582079
Mdc1 NM_001010833 cleavage mm9 chr17:35995884-35995904:+ n 25582079
Nop16 NM_178605 cleavage mm9 chr13:54686352-54686372:- n 25582079
Rad1 NM_011232 cleavage mm9 chr15:10423219-10423239:+ n 25582079
Neu3 NM_016720 cleavage mm9 chr7:106960466-106960486:- n 25582079
Cwc25 NM_026186 cleavage mm9 chr11:97607092-97607112:- n 25582079
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
NONMMUT002538 cleavage mm9 chr1:132619500-132619520:+ n N/A
Gm11739 ENSMUST00000125269.1 NONMMUT012829 cleavage mm9 chr11:116335247-116335267:+ n N/A
NONMMUT021455 cleavage mm9 chr14:70558136-70558156:+ n N/A
Gm12841 ENSMUST00000128263.1 NONMMUT048950 cleavage mm9 chr4:117561089-117561109:+ n N/A
NONMMUT057522 cleavage mm9 chr6:81846335-81846355:- n N/A
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.