Loading...
piRBase Id | piR-mmu-59 | Accession | DQ548941 |
---|---|---|---|
Organism | Mouse | Number of methods | 4 |
Sequence | TGCAAGTTGCTGGCTGTCGGATCTTAAA | Number of papers | 7 |
Length | 28 | Golden piRNA | - |
Aliases | piR-17053; PIR10052; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
15 | GSM822762 | 11 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
16 | GSM822763 | 28 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
17 | GSM822764 | 4 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
31 | GSM684624 | 18 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
32 | GSM684625 | 6 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
38 | GSM684623 | 18 | 22842725 | Mili CLIP | C57BL/6 adult testis |
121 | GSM545783 | 1 | 20534472 | Mov10L1 IP | wild type adult testis |
225 | GSM1528807 | 117 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 191 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 146 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 180 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
347 | GSM475281 | 1 | 20022248 | small RNA | testis |
441 | GSM1096582 | 12 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
443 | GSM1096583 | 8 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
444 | GSM1096600 | 4 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 10 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 49 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
447 | GSM1096585 | 9 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
448 | GSM1096602 | 12 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
449 | GSM1096586 | 16 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 33 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 24 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
452 | GSM1096604 | 28 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 1:92994970-92994998:- | Simple_repeat Simple_repeat (TTTG)n; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0.0938 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
---|---|---|---|
Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. |
PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
---|---|---|---|
Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |