Loading...

Detail Information of piRNA: piR-mmu-59

General Information
piRBase Id piR-mmu-59 Accession DQ548941
Organism Mouse Number of methods 4
Sequence TGCAAGTTGCTGGCTGTCGGATCTTAAA Number of papers 7
Length 28 Golden piRNA -
Aliases piR-17053; PIR10052;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
15 GSM822762 11 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 28 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 18 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 6 22842725 Miwi CLIP C57BL/6 adult testis
38 GSM684623 18 22842725 Mili CLIP C57BL/6 adult testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
225 GSM1528807 117 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 191 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 146 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 180 26588211 small RNA Adult testes Asb1 ao36(KO)
347 GSM475281 1 20022248 small RNA testis 
441 GSM1096582 12 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 8 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 4 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 10 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 49 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 9 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 12 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 16 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 33 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 24 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 28 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:92994970-92994998:- Simple_repeat Simple_repeat (TTTG)n;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0.0938
GSM678422 0
The Expression of piRNA: piR-mmu-59
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.