Loading...
piRBase Id | piR-mmu-5855 | Accession | DQ554214 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TGGCTATGGATTCCAGAAGATTGAATCTC | Number of papers | 9 |
Length | 29 | Golden piRNA | - |
Aliases | piR-21326; PIR15325; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
12 | GSM822758 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
51 | GSM610966 | 6 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
61 | GSM319957 | 1 | 18922463 | Miwi2 IP | 16.5 dpc testis |
66 | GSM509275 | 1 | 20439430 | small RNA | MitoPLD+/+ E16.5 testis |
115 | GSM958036 | 20 | 22902560 | Mili IP | Fkbp6 -/-,P0,testis |
116 | GSM958037 | 8 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
117 | GSM958038 | 5 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
119 | GSM958040 | 3 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
120 | GSM958041 | 25 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
348 | GSM3772906 | 6 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
349 | GSM3772907 | 1 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
350 | GSM3772908 | 5 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
351 | GSM3772909 | 1 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
352 | GSM3772910 | 2 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
365 | GSM2500217 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: 8 to 10 weeks old, female mice; B6D2F1) |
442 | GSM1096599 | 74 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
443 | GSM1096583 | 6 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
444 | GSM1096600 | 31 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 1 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 19 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 3:112266537-112266566:+ | LINE L1 Lx2; | |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0.8221 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0.5154 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
---|---|---|---|
Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 32674113 | Journal | Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5. |
---|---|---|---|
Title | SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation. | ||
Authors | Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D. |
PubMed | 31358756 | Journal | Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8. |
---|---|---|---|
Title | Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes. | ||
Authors | Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |