Loading...

Detail Information of piRNA: piR-mmu-579

General Information
piRBase Id piR-mmu-579 Accession DQ549341
Organism Mouse Number of methods 3
Sequence TGCAGTGACCAGGGAGGAGGGAGGAG Number of papers 7
Length 26 Golden piRNA -
Aliases piR-17453; PIR10452;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
118 GSM958039 1 22902560 Mili IP Tdrd1 +/-,E18,testis
121 GSM545783 3 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 1 20022248 Mili IP adult testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 7 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 1 20022248 Mili-IP testis 
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:114850994-114851020:- SINE Alu B1_Mus1;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.6213
Sample CPM
GSM400968 0.3908
GSM400969 0
GSM433288 0
GSM433289 0.4375
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 0.0909
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-579
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.