Loading...
| piRBase Id | piR-mmu-5735 | Accession | DQ554104 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | TGGCCTCGAACTCAGAAATCTGCCTGCCT | Number of papers | 10 |
| Length | 29 | Golden piRNA | - |
| Aliases | piR-21216; PIR15215; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 6 | GSM113695 | 1 | 16778019 | Chromatography | testes tissue from Swiss Webster male mice, 8-10 weeks old |
| 14 | GSM822761 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 51 | GSM610966 | 2 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 77 | N/A | 1 | 22020280 | Mili IP | Miwi2+/-_1 E16.5 fetal testis |
| 226 | GSM1528808 | 2 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 3 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 2 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 246 | GSM1318059 | 26 | 25262350 | small RNA | E16.5 whole testes |
| 247 | GSM1318060 | 10 | 25262350 | small RNA | E16.5 whole testes Hsp90-alpha KO |
| 348 | GSM3772906 | 4 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
| 349 | GSM3772907 | 5 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
| 351 | GSM3772909 | 4 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 352 | GSM3772910 | 4 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 353 | GSM3772911 | 4 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
| 364 | GSM2500216 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: 8 to 10 weeks old, female mice; B6D2F1) |
| 442 | GSM1096599 | 64 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 1 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 8 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 18 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 1 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 4 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 8 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 13:96276246-96276275:+ | ||
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0 |
| GSM433289 | 0 |
| GSM433290 | 0 |
| GSM433291 | 0 |
| GSM433292 | 0.2431 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 16778019 | Journal | Science. 2006 Jul 21;313(5785):363-7. |
|---|---|---|---|
| Title | Characterization of the piRNA complex from rat testes. | ||
| Authors | Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
|---|---|---|---|
| Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
| Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. | ||
| PubMed | 32674113 | Journal | Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5. |
|---|---|---|---|
| Title | SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation. | ||
| Authors | Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D. | ||
| PubMed | 31358756 | Journal | Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8. |
|---|---|---|---|
| Title | Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes. | ||
| Authors | Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||