Loading...

Detail Information of piRNA: piR-mmu-5735

General Information
piRBase Id piR-mmu-5735 Accession DQ554104
Organism Mouse Number of methods 4
Sequence TGGCCTCGAACTCAGAAATCTGCCTGCCT Number of papers 10
Length 29 Golden piRNA -
Aliases piR-21216; PIR15215;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
14 GSM822761 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
51 GSM610966 2 21602304 small RNA Male germ cell, Pachytene spermatocytes
77 N/A 1 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
226 GSM1528808 2 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 3 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 2 26588211 small RNA Adult testes Asb1 ao36(KO)
246 GSM1318059 26 25262350 small RNA E16.5 whole testes
247 GSM1318060 10 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
348 GSM3772906 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 5 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
364 GSM2500216 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
442 GSM1096599 64 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 1 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 8 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 18 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 4 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 8 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
10745 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 13:96276246-96276275:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0.2431
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-5735
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.