Loading...

Detail Information of piRNA: piR-mmu-569

General Information
piRBase Id piR-mmu-569 Accession DQ549318
Organism Mouse Number of methods 4
Sequence TGCAGTACGGAGAGAGGGATGCTGGT Number of papers 12
Length 26 Golden piRNA Y
Aliases piR-17430; PIR10429;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
12 GSM822758 2 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
14 GSM822761 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
35 GSM684620 6 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 5 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 3 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 7 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 166 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 55 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 6 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 4 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 10 20439430 small RNA Mili-/- E16.5 testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
121 GSM545783 395 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 252 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 224 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 6 20022248 Miwi IP adult testis
133 GSM475280 140 20022248 Mili IP adult testis
225 GSM1528807 134 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 146 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 253 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 174 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 162 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 713 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 254 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 89 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 6 20022248 Miwi-IP testis 
346 GSM475280 140 20022248 Mili-IP testis 
347 GSM475281 46 20022248 small RNA testis 
441 GSM1096582 26 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 100 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 64 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 180 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 147 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 26 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 53 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 118 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 209 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 52 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 74 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27320020-27320046:-
piRNA Expression
Sample CPM
GSM400968 7.0342
GSM400969 7.3571
GSM433288 37.9386
GSM433289 155.9623
GSM433290 53.9429
GSM433291 31.6597
GSM433292 55.6764
GSM433293 82.9493
GSM433294 0
GSM433295 0.2378
GSM475279 0.5763
GSM475280 12.7288
GSM475281 4.3154
GSM678422 0
The Expression of piRNA: piR-mmu-569
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.