Loading...

Detail Information of piRNA: piR-mmu-568500

General Information
piRBase Id piR-mmu-568500 Accession N/A
Organism Mouse Number of methods 4
Sequence TGTGTTTGAATGCTTGGCCATAGGGAGTG Number of papers 7
Length 29 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 18 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 4 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 8 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 10 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 4 22842725 Miwi CLIP C57BL/6 adult testis
36 GSM684621 44 22842725 Mili CLIP C57BL/6 adult testis
132 GSM475279 4 20022248 Miwi IP adult testis
133 GSM475280 3 20022248 Mili IP adult testis
217 GSM1653802 1 25582079 MIWI CLIP round spermatids
225 GSM1528807 17 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 24 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 39 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 31 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 17 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 24 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 26 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 5 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 4 20022248 Miwi-IP testis 
346 GSM475280 3 20022248 Mili-IP testis 
347 GSM475281 1 20022248 small RNA testis 
441 GSM1096582 8 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 50 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 9 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 30 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 67 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 41 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 2 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 74 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 6 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 29 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
45 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:31138443-31138472:+ LTR ERVL-MaLR ORR1B1;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.9812
GSM433289 5.2498
GSM433290 5.5217
GSM433291 1.7786
GSM433292 1.4588
GSM433293 4.2538
GSM433294 0
GSM433295 0
GSM475279 0.3842
GSM475280 0.2728
GSM475281 0.0938
GSM678422 0
The Expression of piRNA: piR-mmu-568500
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
4930558J18Rik NR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavage mm9 chr1:57416233-57416253:- n N/A
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.