Loading...

Detail Information of piRNA: piR-mmu-568499

General Information
piRBase Id piR-mmu-568499 Accession N/A
Organism Mouse Number of methods 4
Sequence TGTGTTTGAATGCTTGGCCATAGGGA Number of papers 10
Length 26 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
14 GSM822761 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
31 GSM684624 20 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 3 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 56 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 36 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 4 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 45 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 33 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
63 GSM319959 3 18922463 small RNA 2 dpp testis
64 GSM319960 7 18922463 small RNA 10 dpp testis
85 N/A 1 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
117 GSM958038 3 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
132 GSM475279 6 20022248 Miwi IP adult testis
133 GSM475280 39 20022248 Mili IP adult testis
224 GSM1528806 14 26588211 small RNA 10dpp testes
225 GSM1528807 46 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 133 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 157 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 153 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 14 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 48 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 42 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 15 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 6 20022248 Miwi-IP testis 
346 GSM475280 39 20022248 Mili-IP testis 
347 GSM475281 16 20022248 small RNA testis 
441 GSM1096582 25 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 50 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 166 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 108 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 235 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 469 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 19 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 17 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 66 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 65 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 37 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 12 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
62 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 13:104829060-104829086:- Srek1ip1 ENSMUST00000145661; Srek1ip1 ENSMUST00000022230; Srek1ip1 ENSMUST00000156105; Srek1ip1 ENSMUST00000137278;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0.7538
GSM319954 0
GSM319955 0.6068
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 2.049
GSM319960 3.4935
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.2786
GSM433289 10.4996
GSM433290 8.9197
GSM433291 5.3359
GSM433292 4.3763
GSM433293 7.2315
GSM433294 0
GSM433295 0
GSM475279 0.5763
GSM475280 3.5459
GSM475281 1.501
GSM678422 0.0531
The Expression of piRNA: piR-mmu-568499
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
4930558J18Rik NR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavage mm9 chr1:57416233-57416253:- n N/A
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.