Loading...
piRBase Id | piR-mmu-568499 | Accession | N/A |
---|---|---|---|
Organism | Mouse | Number of methods | 4 |
Sequence | TGTGTTTGAATGCTTGGCCATAGGGA | Number of papers | 10 |
Length | 26 | Golden piRNA | - |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
11 | GSM822760 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
14 | GSM822761 | 5 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
31 | GSM684624 | 20 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
35 | GSM684620 | 3 | 22842725 | Mili CLIP | C57BL/6 adult testis |
36 | GSM684621 | 56 | 22842725 | Mili CLIP | C57BL/6 adult testis |
38 | GSM684623 | 36 | 22842725 | Mili CLIP | C57BL/6 adult testis |
50 | GSM610965 | 4 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
51 | GSM610966 | 45 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
52 | GSM610967 | 33 | 21602304 | small RNA | Male germ cell, Round spermatids |
57 | GSM319953 | 1 | 18922463 | Mili IP | 10 dpp Dnmt3L heterozygotes testis |
59 | GSM319955 | 1 | 18922463 | small RNA | 16.5 dpc testis |
63 | GSM319959 | 3 | 18922463 | small RNA | 2 dpp testis |
64 | GSM319960 | 7 | 18922463 | small RNA | 10 dpp testis |
85 | N/A | 1 | 22020280 | Miwi2 IP | Miwi2DAH_1 E16.5 fetal testis |
88 | N/A | 1 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
115 | GSM958036 | 1 | 22902560 | Mili IP | Fkbp6 -/-,P0,testis |
117 | GSM958038 | 3 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
119 | GSM958040 | 1 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
132 | GSM475279 | 6 | 20022248 | Miwi IP | adult testis |
133 | GSM475280 | 39 | 20022248 | Mili IP | adult testis |
224 | GSM1528806 | 14 | 26588211 | small RNA | 10dpp testes |
225 | GSM1528807 | 46 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 133 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 157 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 153 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
234 | GSM433288 | 14 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
235 | GSM433289 | 48 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
236 | GSM433290 | 42 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
237 | GSM433291 | 15 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
345 | GSM475279 | 6 | 20022248 | Miwi-IP | testis |
346 | GSM475280 | 39 | 20022248 | Mili-IP | testis |
347 | GSM475281 | 16 | 20022248 | small RNA | testis |
441 | GSM1096582 | 25 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
442 | GSM1096599 | 50 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
443 | GSM1096583 | 166 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
444 | GSM1096600 | 108 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 235 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 469 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
447 | GSM1096585 | 19 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
448 | GSM1096602 | 17 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
449 | GSM1096586 | 66 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 65 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 37 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
452 | GSM1096604 | 12 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 13:104829060-104829086:- | Srek1ip1 ENSMUST00000145661; Srek1ip1 ENSMUST00000022230; Srek1ip1 ENSMUST00000156105; Srek1ip1 ENSMUST00000137278; | |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0.7538 |
GSM319954 | 0 |
GSM319955 | 0.6068 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 2.049 |
GSM319960 | 3.4935 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 3.2786 |
GSM433289 | 10.4996 |
GSM433290 | 8.9197 |
GSM433291 | 5.3359 |
GSM433292 | 4.3763 |
GSM433293 | 7.2315 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0.5763 |
GSM475280 | 3.5459 |
GSM475281 | 1.501 |
GSM678422 | 0.0531 |
No record. |
Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
---|---|---|---|---|---|
4930558J18Rik | NR_037999 ENSMUST00000181949.2 NONMMUT000996 | cleavage | mm9 chr1:57416233-57416253:- | n | N/A |
No record. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
---|---|---|---|
Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
---|---|---|---|
Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |