Loading...

Detail Information of piRNA: piR-mmu-5664

General Information
piRBase Id piR-mmu-5664 Accession DQ540404
Organism Mouse Number of methods 3
Sequence CAAGAACGGAAAGCTTACGTCTACACGGC Number of papers 10
Length 29 Golden piRNA Y
Aliases piR-516; PIR1515; PIR188783;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
5 N/A N/A 16751777 MILI IP testis
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
51 GSM610966 10 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 10 21602304 small RNA Male germ cell, Round spermatids
68 GSM509277 1 20439430 small RNA Mili-/- E16.5 testis
126 GSM466728 12 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 16 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 4 20022248 Miwi IP adult testis
133 GSM475280 344 20022248 Mili IP adult testis
224 GSM1528806 5 26588211 small RNA 10dpp testes
225 GSM1528807 38 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 78 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 66 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 85 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 5 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 8 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 5 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 4 26115953 small RNA 6 weeks hetero tdrd6 KO testes
345 GSM475279 4 20022248 Miwi-IP testis 
346 GSM475280 344 20022248 Mili-IP testis 
347 GSM475281 37 20022248 small RNA testis 
441 GSM1096582 3 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 160 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 298 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 237 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 910 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 29 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 118 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 46 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 115 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 20 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 67 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27364594-27364623:+ Gm49794 ENSMUST00000232133; SINE B4 ID_B1;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0.3344
GSM433288 1.1709
GSM433289 1.7499
GSM433290 1.0619
GSM433291 0.3557
GSM433292 0.9725
GSM433293 2.1269
GSM433294 0
GSM433295 0
GSM475279 0.3842
GSM475280 31.2766
GSM475281 3.4711
GSM678422 0
The Expression of piRNA: piR-mmu-5664
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.