Loading...

Detail Information of piRNA: piR-mmu-565414

General Information
piRBase Id piR-mmu-565414 Accession N/A
Organism Mouse Number of methods 4
Sequence TGTGACTTCATTGAGACGTATTATCTGA Number of papers 16
Length 28 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
38 GSM684623 51 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 6 21602304 small RNA Male germ cell, Type A spermatogonia
52 GSM610967 3 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 3 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 6 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 2 18922463 small RNA 16.5 dpc testis
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
66 GSM509275 12 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 31 20439430 small RNA Mili-/- E16.5 testis
69 GSM509278 12 20439430 small RNA Miwi2-/- E16.5 testis
70 GSM509279 51 20439430 small RNA MVH-/- E16.5 testis
73 N/A 163 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 5 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 2 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 52 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
78 N/A 12 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 22 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 5 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 35 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 30 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 2 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
85 N/A 4 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
88 N/A 4 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 64 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 3 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 562 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 10 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 118 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 11 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
121 GSM545783 2 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 377 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 371 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 106 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 86 20059948 Mili IP Tdrd9-/- 14dpp testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 42 20022248 Mili IP adult testis
224 GSM1528806 443 26588211 small RNA 10dpp testes
225 GSM1528807 13 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 15 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 22 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 28 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 5 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 6 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 3 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 2 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 42 20022248 Mili-IP testis 
347 GSM475281 2 20022248 small RNA testis 
348 GSM3772906 64 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 52 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 112 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 52 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 53 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 54 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
355 GSM4635228 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
356 GSM4635229 2 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
357 GSM4635230 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
359 GSM4635232 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
441 GSM1096582 17 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 86 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 290 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 1007 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 119 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 417 23523368 oxidized small RNA Wild Type 14.5 dpp testes
448 GSM1096602 9 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 10 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 12 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 4 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 6 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 19:9984783-9984811:+ Fth1 ENSMUST00000235196; Fth1 ENSMUST00000025563; Fth1 ENSMUST00000237316; Fth1 ENSMUST00000235407; Fth1 ENSMUST00000235129; Fth1 ENSMUST00000236403; SINE B4 ID_B1;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 2.2613
GSM319954 2.7895
GSM319955 1.2136
GSM319956 0
GSM319957 0.5154
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 2.796
Sample CPM
GSM400968 5.8618
GSM400969 122.3952
GSM433288 1.1709
GSM433289 0.4375
GSM433290 1.2742
GSM433291 1.0672
GSM433292 0
GSM433293 0.4254
GSM433294 0.4693
GSM433295 0.9513
GSM475279 0.0961
GSM475280 3.8186
GSM475281 0.1876
GSM678422 0
The Expression of piRNA: piR-mmu-565414
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.