Loading...

Detail Information of piRNA: piR-mmu-559

General Information
piRBase Id piR-mmu-559 Accession DQ703335
Organism Mouse Number of methods 5
Sequence AACTAATATCAGTTGTGTTACTACATGTCC Number of papers 9
Length 30 Golden piRNA -
Aliases piR-43; piR-118657; PIR1042; PIR211983;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 34 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 2 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 15 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 21 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 16 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 11 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 29 22842725 Miwi CLIP C57BL/6 adult testis
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
217 GSM1653802 13 25582079 MIWI CLIP round spermatids
225 GSM1528807 2 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 13 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 15 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 8 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
237 GSM433291 2 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 1 26115953 small RNA 6 weeks hetero tdrd6 KO testes
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
446 GSM1096601 23 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 2 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 2 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 2 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 13 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 7 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:149822400-149822430:- LINE L1 Lx8b;
piRNA Expression
The Expression of piRNA: piR-mmu-559

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.