Loading...

Detail Information of piRNA: piR-mmu-5575

General Information
piRBase Id piR-mmu-5575 Accession DQ710305
Organism Mouse Number of methods 5
Sequence TGGCCAAGGTGACATTTGCTTGGTGGT Number of papers 9
Length 27 Golden piRNA -
Aliases piR-21055; piR-125627; PIR15054; PIR218953;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
31 GSM684624 3 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 1 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 61 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 30 22842725 Mili CLIP C57BL/6 adult testis
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
62 GSM319958 1 18922463 small RNA 4-6 week ovary
133 GSM475280 9 20022248 Mili IP adult testis
225 GSM1528807 24 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 32 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 43 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 32 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 18 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 32 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 26 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 21 26115953 small RNA 25dpp homo tdrd6 KO testes
346 GSM475280 9 20022248 Mili-IP testis 
347 GSM475281 6 20022248 small RNA testis 
441 GSM1096582 3 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 5 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 40 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 2 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 5 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 30 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 45 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 18 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 13 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27356618-27356645:+ Gm49794 ENSMUST00000232133; SINE B2 B2_Mm2;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 1.6113
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 4.2154
GSM433289 6.9997
GSM433290 5.5217
GSM433291 7.4703
GSM433292 2.6744
GSM433293 5.53
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0.8183
GSM475281 0.5629
GSM678422 0
The Expression of piRNA: piR-mmu-5575
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.