Loading...

Detail Information of piRNA: piR-mmu-5537

General Information
piRBase Id piR-mmu-5537 Accession DQ540391
Organism Mouse Number of methods 2
Sequence CAACAGGATCCTTCTGCACACGTTTATTGG Number of papers 5
Length 30 Golden piRNA -
Aliases piR-503; PIR1502;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
14 GSM822761 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
79 N/A 1 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 1 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
82 N/A 2 22020280 Mili IP wild_type_2 E16.5 fetal testis
85 N/A 19 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 2 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
88 N/A 6 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
238 GSM433292 1 26115953 small RNA 6 weeks hetero tdrd6 KO testes
Location in GRCm38
1712 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:133228458-133228488:+ Low_complexity Low_complexity GA-rich;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
The Expression of piRNA: piR-mmu-5537
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ