Loading...
piRBase Id | piR-mmu-5537 | Accession | DQ540391 |
---|---|---|---|
Organism | Mouse | Number of methods | 2 |
Sequence | CAACAGGATCCTTCTGCACACGTTTATTGG | Number of papers | 5 |
Length | 30 | Golden piRNA | - |
Aliases | piR-503; PIR1502; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
12 | GSM822758 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
14 | GSM822761 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
16 | GSM822763 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
79 | N/A | 1 | 22020280 | Mili IP | Miwi2-/-_1 E16.5 fetal testis |
80 | N/A | 1 | 22020280 | Mili IP | Miwi2-/-_2 E16.5 fetal testis |
82 | N/A | 2 | 22020280 | Mili IP | wild_type_2 E16.5 fetal testis |
85 | N/A | 19 | 22020280 | Miwi2 IP | Miwi2DAH_1 E16.5 fetal testis |
86 | N/A | 2 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
88 | N/A | 6 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
227 | GSM1528809 | 1 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
238 | GSM433292 | 1 | 26115953 | small RNA | 6 weeks hetero tdrd6 KO testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 2:133228458-133228488:+ | Low_complexity Low_complexity GA-rich; | |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0.2431 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
---|---|---|---|
Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |